Merck
CN
All Photos(1)

Documents

Safety Information

EHU129801

Sigma-Aldrich

MISSION® esiRNA

targeting human PRSS12

Sign Into View Organizational & Contract Pricing
All Photos(1)
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCACAGCAGCACACTGTTTCAAGAGGTATGGCAACAGCACTAGGAGCTATGCTGTTAGGGTTGGAGATTATCATACTCTGGTACCAGAGGAGTTTGAGGAAGAAATTGGAGTTCAACAGATTGTGATTCATCGGGAGTATCGACCCGACCGCAGTGATTATGACATAGCCCTGGTTAGATTACAAGGACCAGAAGAGCAATGTGCCAGATTCAGCAGCCATGTTTTGCCAGCCTGTTTACCACTCTGGAGAGAGAGGCCACAGAAAACAGCATCCAACTGTTACATAACAGGATGGGGTGACACAGGACGAGCCTATTCAAGAACACTACAACAAGCAGCCATTCCCTTACTTCCTAAAAGGTTTTGTGAAGAACGTTATAAGGGTCGGTTTACAGGGAGAATGCTTTGTGCTGGAAACCTCCATGAACACAAACGCGTGGACAGCTGCCAGGGAGACAGCGGAGGACCACTCATGTGTGAACGGCCCGGAGAGAGCTGGGTGGTGTATGGGGTGACCTC

Ensembl | human accession no.

ENSG00000164099

NCBI accession no.

NM_003619

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRSS12(8492) , PRSS12(8492)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Ah-Rong Nam et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(3), 886-900 (2018-10-05)
Jab1 is a coactivator of c-Jun that enhances the transcriptional function of c-Jun. Jab1 is frequently overexpressed in various cancers and is associatedwith poor prognosis of cancer patients. Thus, Jab1 could be a potential therapeutic target in cancer. However, the
Judit Iván et al.
Stem cells and development, 26(23), 1724-1733 (2017-10-11)
Free fatty acid receptor 2 (FFAR2, also known as GPR43) is a G-protein-coupled receptor activated by short-chain fatty acids that are produced by gut microbiota through fermentation of nondigestible carbohydrates. FFAR2 functions as a metabolic sensor and is expressed in
J J Souchek et al.
British journal of cancer, 111(6), 1139-1149 (2014-07-16)
Despite its promise as a highly useful therapy for pancreatic cancer (PC), the addition of external beam radiation therapy to PC treatment has shown varying success in clinical trials. Understanding PC radioresistance and discovery of methods to sensitise PC to
Yang Zhang et al.
American journal of physiology. Lung cellular and molecular physiology, 307(2), L173-L185 (2014-05-20)
The inflammatory response is a primary mechanism in the pathogenesis of ventilator-induced lung injury. Autophagy is an essential, homeostatic process by which cells break down their own components. We explored the role of autophagy in the mechanisms of mechanical ventilation-induced
Shun-Yao Ko et al.
PloS one, 9(10), e110542-e110542 (2014-10-21)
Advanced glycation end products (AGEs) are produced in an irreversible non-enzymatic reaction of carbohydrates and proteins. Patients with diabetes mellitus (DM) are known to have elevated AGE levels, which is viewed as a risk factor of diabetes-related complications. In a
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service