Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGATTTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGGATGGCAGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... JAK2(3717)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Li-Xue Zou et al.
Cells, tissues, organs, 208(1-2), 13-24 (2020-02-12)
The aim of this work was to determine the effect of miR-375 on chondrocyte metabolism and oxidative stress in osteoarthritis (OA) mouse models through the JAK2/STAT3 signaling pathway. Chondrocytes were divided into control, IL-1β, IL-1β + miR-375 mimic, IL-1β +
Kong Chen et al.
Acta biochimica et biophysica Sinica, 52(8), 832-841 (2020-08-14)
Interleukin-5 (IL-5) is manifested as its involvement in the process of atherosclerosis, but the mechanism is still unknown. In this study, we explored the effect of IL-5 on lipid metabolism and its underlying mechanisms in THP-1-derived macrophages. The quantitative polymerase
Wudian Xiao et al.
Microbial pathogenesis, 144, 104175-104175 (2020-04-01)
Trichophyton mentagrophytes (T. mentagrophytes) is the main cause of rabbit dermatophytosis. As the main pathogen-associated molecular pattern of T. mentagrophytes, the role of β-glucan in the pathogenesis of rabbit dermatophytosis remains elusive. Keratinocytes (KC) are the main cellular component and the first
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU130881-50UG | 04061828457762 |
| EHU130881-20UG | 04061831363883 |