Skip to Content
Merck
CN

EHU130951

MISSION® esiRNA

targeting human OVOL1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCCAGTGGAGACCTGTTCACCTGCCGTGTCTGCCAGAAGGCCTTCACCTACCAGCGCATGCTGAACCGCCACATGAAGTGTCACAACGACGTCAAGAGGCACCTCTGCACGTACTGCGGGAAGGGCTTCAATGACACCTTCGACCTCAAGAGACACGTCCGAACTCACACTGGCGTGCGGCCCTACAAGTGCAGCCTGTGTGACAAGGCCTTCACGCAGCGCTGCTCTCTGGAGTCTCACCTCAAGAAGATCCATGGTGTGCAGCAGAAGTACGCGTACAAGGAGCGGCGGGCCAAGCTGTACGTGTGTGAGGAGTGCGGCTGCACATCTGAGAGCCAGGAGGGCCACGTCCTGCACCTGAAGGAGCACCACCCTGACAGCCCGCTGCTGCGCAAGACCTCCAAGAAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Akiko Hashimoto-Hachiya et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Rhodiola species are antioxidative, salubrious plants that are known to inhibit oxidative stress induced by ultraviolet and γ-radiation in epidermal keratinocytes. As certain phytochemicals activate aryl hydrocarbon receptors (AHR) or OVO-like 1 (OVOL1) to upregulate the expression of epidermal barrier
Maho Murata et al.
Journal of clinical medicine, 9(3) (2020-02-29)
Progression of actinic keratosis (AK) to cutaneous squamous cell carcinoma (cSCC) is rare. Most cases of AK remain as intraepidermal lesions, owing to the suppression of the epithelial-to-mesenchymal transition (EMT). Ovo-like transcriptional repressor 1 (OVOL1) and ovo-like zinc finger 2
Stephen J Renaud et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(45), E6175-E6184 (2015-10-28)
Epithelial barrier integrity is dependent on progenitor cells that either divide to replenish themselves or differentiate into a specialized epithelium. This paradigm exists in human placenta, where cytotrophoblast cells either propagate or undergo a unique differentiation program: fusion into an

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service