Skip to Content
Merck
CN

EHU131101

MISSION® esiRNA

targeting human POLD1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAGAAACTGGGCCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGAGTTTGTGAAGACCTCAGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGTGCCCGGAAGAGGGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCCGGCGCCAGGTCCTGGATGGACGGCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGTATACGGCTTCACTGGCGCCCAGGTGGGCAAGTTGCCGTGCCTGGAGATCTCACAGAGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCTAAGTACACAGTGGAGAATGGCTACAGCACCAGTGCCAAGGTGGTGTATGGTGACACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAGGCGATGGCCCTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Albert Job et al.
Scientific reports, 10(1), 18924-18924 (2020-11-05)
Inhibition of the kinase ATR, a central regulator of the DNA damage response, eliminates subsets of cancer cells in certain tumors. As previously shown, this is at least partly attributable to synthetic lethal interactions between ATR and POLD1, the catalytic
Qinghong Qin et al.
Oncology letters, 16(5), 5591-5598 (2018-10-23)
Polymerase δ catalytic subunit gene 1 (POLD1) may serve an important function in the development of tumors. However, its role in breast cancer remains unclear. The aim of the present study was to observe the expression and the function of
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service