Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGAGACAAGACCAAATGGATTCTTGGAGTATGTAGTGAGTCAGTGAGCAGGAAGGGGAAGGTTACTGCCTCACCTGCCAATGGACACTGGCTTCTGCGACAGAGTCGTGGGAATGAGTATGAAGCTCTCACATCCCCGCAGACCTCCTTCCGCCTTAAAGAGCCTCCACGGTGTGTGGGGATTTTCCTGGACTATGAAGCAGGAGTCATCTCTTTCTACAATGTGACCAACAAGTCCCACATCTTTACTTTCACCCACAATTTCTCTGGCCCCCTTCGCCCTTTCTTTGAACCTTGCCTTCATGATGGAGGAAAAAACACAGCACCTCTAGTCATTTGTTCAGAACTACACAAATCAGAGGAATCAATTGTCCCCAGGCCAGAAGGGAAAGGCCATGCTAATGGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ERMAP(114625)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chen-Chu Lin et al.
Oncology letters, 21(3), 232-232 (2021-02-23)
MicroRNAs (miRNAs/miRs) are known to play a key role in tumorigenesis and usually serve as therapeutic targets in cancer treatment. In the present study, the inhibitory effects and the targeting miRNAs of withaferin A (WA) were investigated in human lung
Khaled Hached et al.
The Journal of cell biology, 218(2), 541-558 (2019-01-11)
Greatwall (GWL) is an essential kinase that indirectly controls PP2A-B55, the phosphatase counterbalancing cyclin B/CDK1 activity during mitosis. In Xenopus laevis egg extracts, GWL-mediated phosphorylation of overexpressed ARPP19 and ENSA turns them into potent PP2A-B55 inhibitors. It has been shown
Sujeong Yeom et al.
The Journal of general virology, 99(5), 655-666 (2018-04-04)
Proteasomal activator gamma (PA28γ), frequently overexpressed in hepatocellular carcinoma, is believed to play important roles in tumourigenesis. However, the underlying mechanism of PA28γ overexpression and its possible roles in hepatitis B virus (HBV) replication are largely unknown. In the present
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU158011-50UG | 04061828419500 |
| EHU158011-20UG | 04061828644353 |