Skip to Content
Merck
CN

EHU158011

MISSION® esiRNA

targeting human ERMAP

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGACAAGACCAAATGGATTCTTGGAGTATGTAGTGAGTCAGTGAGCAGGAAGGGGAAGGTTACTGCCTCACCTGCCAATGGACACTGGCTTCTGCGACAGAGTCGTGGGAATGAGTATGAAGCTCTCACATCCCCGCAGACCTCCTTCCGCCTTAAAGAGCCTCCACGGTGTGTGGGGATTTTCCTGGACTATGAAGCAGGAGTCATCTCTTTCTACAATGTGACCAACAAGTCCCACATCTTTACTTTCACCCACAATTTCTCTGGCCCCCTTCGCCCTTTCTTTGAACCTTGCCTTCATGATGGAGGAAAAAACACAGCACCTCTAGTCATTTGTTCAGAACTACACAAATCAGAGGAATCAATTGTCCCCAGGCCAGAAGGGAAAGGCCATGCTAATGGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lilly Y W Bourguignon et al.
Matrix biology : journal of the International Society for Matrix Biology, 78-79, 180-200 (2018-08-06)
Head and neck squamous cell carcinoma (HNSCC) is a malignancy that often involves the oral cavity, pharynx, larynx, or paranasal sinuses. There is a compelling evidence of the human papilloma virus including HPV16 E6 oncogene drives cell transformation and oncogenic
Yong Shen et al.
Journal of cellular biochemistry, 119(1), 712-722 (2017-06-29)
Transcription factor TFII-I is a multifunctional protein implicated in the regulation of cell cycle and stress-response genes. Previous studies have shown that a subset of TFII-I associated genomic sites contained DNA-binding motifs for E2F family transcription factors. We analyzed the
Chen-Chu Lin et al.
Oncology letters, 21(3), 232-232 (2021-02-23)
MicroRNAs (miRNAs/miRs) are known to play a key role in tumorigenesis and usually serve as therapeutic targets in cancer treatment. In the present study, the inhibitory effects and the targeting miRNAs of withaferin A (WA) were investigated in human lung
Etienne Malvoisin et al.
Electrophoresis, 36(11-12), 1251-1255 (2015-01-30)
Based on their characteristics, we hypothesized that the following parameters, namely collagen IV, glutathione S-transferase, secretory component (SC), and AMP-activated protein kinase α1α2 may be useful serum markers in the detection of comorbidities in treated HIV-infected patients. These parameters were
Sujeong Yeom et al.
The Journal of general virology, 99(5), 655-666 (2018-04-04)
Proteasomal activator gamma (PA28γ), frequently overexpressed in hepatocellular carcinoma, is believed to play important roles in tumourigenesis. However, the underlying mechanism of PA28γ overexpression and its possible roles in hepatitis B virus (HBV) replication are largely unknown. In the present

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service