Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGAGACAAGACCAAATGGATTCTTGGAGTATGTAGTGAGTCAGTGAGCAGGAAGGGGAAGGTTACTGCCTCACCTGCCAATGGACACTGGCTTCTGCGACAGAGTCGTGGGAATGAGTATGAAGCTCTCACATCCCCGCAGACCTCCTTCCGCCTTAAAGAGCCTCCACGGTGTGTGGGGATTTTCCTGGACTATGAAGCAGGAGTCATCTCTTTCTACAATGTGACCAACAAGTCCCACATCTTTACTTTCACCCACAATTTCTCTGGCCCCCTTCGCCCTTTCTTTGAACCTTGCCTTCATGATGGAGGAAAAAACACAGCACCTCTAGTCATTTGTTCAGAACTACACAAATCAGAGGAATCAATTGTCCCCAGGCCAGAAGGGAAAGGCCATGCTAATGGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ERMAP(114625)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lilly Y W Bourguignon et al.
Matrix biology : journal of the International Society for Matrix Biology, 78-79, 180-200 (2018-08-06)
Head and neck squamous cell carcinoma (HNSCC) is a malignancy that often involves the oral cavity, pharynx, larynx, or paranasal sinuses. There is a compelling evidence of the human papilloma virus including HPV16 E6 oncogene drives cell transformation and oncogenic
Yong Shen et al.
Journal of cellular biochemistry, 119(1), 712-722 (2017-06-29)
Transcription factor TFII-I is a multifunctional protein implicated in the regulation of cell cycle and stress-response genes. Previous studies have shown that a subset of TFII-I associated genomic sites contained DNA-binding motifs for E2F family transcription factors. We analyzed the
Chen-Chu Lin et al.
Oncology letters, 21(3), 232-232 (2021-02-23)
MicroRNAs (miRNAs/miRs) are known to play a key role in tumorigenesis and usually serve as therapeutic targets in cancer treatment. In the present study, the inhibitory effects and the targeting miRNAs of withaferin A (WA) were investigated in human lung
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU158011-50UG | 04061828419500 |
| EHU158011-20UG | 04061828644353 |