Skip to Content
Merck
CN

EMU035101

MISSION® esiRNA

targeting mouse Rap2b

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCTTCCAGGACATCAAGCCCATGCGGGACCAGATCATCCGCGTGAAGCGGTACGAGCGCGTACCCATGATCCTGGTAGGCAACAAGGTGGACTTGGAGGGTGAACGTGAGGTCTCCTATGGCGAGGGTAAGGCCCTGGCCGAGGAGTGGAGCTGCCCCTTCATGGAGACATCGGCCAAAAACAAAGCCTCAGTGGATGAGCTATTCGCAGAGATCGTGAGGCAGATGAACTACGCGGCACAGCCCAACGGCGACGAGGGCTGCTGCTCGGCCTGCGTGATCCTGTGAGGCGCCGTCTGCCGCCGGGCGCTGGCCACGCTCTGTGCACAAAGCCAAACGCACCCGATTCTCTTAATGTGATTGTCTTCTTGCTTTGAGATTGGAGACGACTTTGTTGTCTTGGCTGGGATGTCCGAGGAACCTGGCTGACTTGTGTAGCCAGCATCCCCAGCCTTCAGCCAGGGTCTGAGAGGGTGTACGTTGCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

María Eugenia Mansilla Pareja et al.
PloS one, 14(2), e0212202-e0212202 (2019-02-15)
Cyclic Adenosine 3',5'-monophosphate (cAMP) is a key second messenger known to directly regulate not only the protein kinase A (PKA) activity but also other important molecules such as the exchange protein activated by cAMP (EPAC), which is as a guanine
Yi-Gen Peng et al.
Journal of receptor and signal transduction research, 36(5), 459-464 (2015-12-17)
Rap2b, a member of the guanosine triphosphate-binding proteins, is widely up-regulated in many types of tumors. However, the functional role of Rap2b in tumorigenesis of lung cancer remains to be fully elucidated. In this study, we investigated the effect of
María Belén Mestre et al.
PLoS pathogens, 8(5), e1002664-e1002664 (2012-06-02)
Staphylococcus aureus is a microorganism that causes serious diseases in the human being. This microorganism is able to escape the phagolysosomal pathway, increasing intracellular bacterial survival and killing the eukaryotic host cell to spread the infection. One of the key

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service