Skip to Content
Merck
CN

EMU047451

MISSION® esiRNA

targeting mouse Frap1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACATTGACTTTGGGGACTGCTTTGAGGTCGCTATGACCAGAGAGAAATTTCCAGAAAAGATTCCATTTAGACTAACAAGAATGTTGACCAATGCTATGGAGGTTACGGGTCTGGATGGCAACTACAGAACCACATGCCACACTGTGATGGAAGTGCTCCGAGAGCACAAGGACAGTGTCATGGCTGTGCTGGAAGCCTTTGTCTATGACCCGCTGCTCAACTGGAGGCTGATGGACACGAATACCAAAGGCAATAAGCGGTCCCGGACAAGGACAGACTCCTACTCTGCCGGCCAGTCAGTAGAAATTTTGGACGGTGTAGAACTTGGAGAACCAGCCCATAAGAAAGCAGGGACCACTGTGCCAGAATCCATCCATTCATTCATTGGAGACGGTTTGGTGAAACCAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

mouse ... Frap1(56717)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Benjamin Frank et al.
Parasites & vectors, 8, 404-404 (2015-08-01)
Autophagy participates in innate immunity by eliminating intracellular pathogens. Consequently, numerous microorganisms have developed strategies to impair the autophagic machinery in phagocytes. In the current study, interactions between Leishmania major (L. m.) and the autophagic machinery of bone marrow-derived macrophages
Hana Schmeisser et al.
Autophagy, 9(5), 683-696 (2013-02-20)
Autophagy is an evolutionarily conserved cellular recycling mechanism that occurs at a basal level in all cells. It can be further induced by various stimuli including starvation, hypoxia, and treatment with cytokines such as IFNG/IFNγ and TGFB/TGFβ. Type I IFNs
Clare F Malone et al.
Cancer discovery, 4(9), 1062-1073 (2014-06-11)
NF1 encodes a RAS GTPase-activating protein. Accordingly, aberrant RAS activation underlies the pathogenesis of NF1-mutant cancers. Nevertheless, it is unclear which RAS pathway components represent optimal therapeutic targets. Here, we identify mTORC1 as the key PI3K effector in NF1-mutant nervous
Anupama Karnam et al.
Molecular immunology, 68(2 Pt A), 280-289 (2015-10-04)
Immune responses during fungal infections are predominately mediated by 5/15-lipoxygenases (LO)- or cyclooxygenase (COX)-2-catalysed bioactive eicosanoid metabolites like leukotrienes, lipoxins and prostaglandins. Although few host mediators of fungi-triggered eicosanoid production have been established, the molecular mechanism of expression and regulation
Chider Chen et al.
The Journal of experimental medicine, 212(1), 73-91 (2014-12-24)
Fibrillin-1 (FBN1) deficiency-induced systemic sclerosis is attributed to elevation of interleukin-4 (IL4) and TGF-β, but the mechanism underlying FBN1 deficiency-associated osteopenia is not fully understood. We show that bone marrow mesenchymal stem cells (BMMSCs) from FBN1-deficient (Fbn1(+/-)) mice exhibit decreased

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service