EMU084881
MISSION® esiRNA
targeting mouse Camk1d
Select a Size
About This Item
Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAAAGCCCAAATCACCTCTACCTGGTCATGCAACTTGTGTCTGGTGGAGAACTCTTCGATCGGATAGTGGAGAAGGGGTTTTACACAGAGAAAGATGCCAGCACTCTCATCCGCCAGGTCCTGGATGCCGTATACTATCTCCACAGAATGGGCATTGTCCACAGGGACCTCAAGCCGGAGAATCTCTTATACTACAGTCAAGACGAGGAGTCCAAAATAATGATCAGTGACTTTGGCTTGTCGAAAATGGAGGGCAAAGGAGATGTGATGTCCACGGCCTGCGGGACCCCAGGCTATGTTGCTCCGGAAGTTCTCGCCCAGAAACCGTACAGCAAAGCTGTGGACTGCTGGTCCATCGGGGTGATCGCCTATATCTTGCTCTGTGGTTACCCTCCTTTTTATGATGAAAATGACTCGAAGCTGTTTGAACAGATCCTCAAGGCAGAATATGAGTTTGATTCCCCCTACTGGGATGACATCTCCGACTCTGCCAAAGA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CAMK1D(227541), Camk1d(227541)
Related Categories
1 of 1
This Item | P2C030C01 | P2C100V01 | P2C100C01 |
|---|---|---|---|
| matrix Ultracel® | matrix Ultracel® | matrix Ultracel® | matrix Ultracel® |
| pore size 30 kDa NMWCO | pore size 30 kDa NMWCO | pore size 100 kDa NMWCO | pore size 100 kDa NMWCO |
| material composite regenerated cellulose (CRC) , polyurethane adhesive, polypropylene screen | material composite regenerated cellulose (CRC) , polypropylene screen, polyurethane adhesive | material composite regenerated cellulose (CRC) , polypropylene screen, polyurethane adhesive | material composite regenerated cellulose (CRC) , polypropylene screen, polyurethane adhesive |
| technique(s) analytical sample preparation: suitable, protein purification: suitable | technique(s) analytical sample preparation: suitable, protein purification: suitable | technique(s) analytical sample preparation: suitable, protein purification: suitable | technique(s) analytical sample preparation: suitable, protein purification: suitable |
| parameter 3.5 bar max. transmembrane pressure (50 psig) at 30 °C | parameter 3.5 bar max. transmembrane pressure (50 psig) at 30 °C, 5-35 L/min recirculation rate at 0.4 bar (6 psi) | parameter 3.5 bar max. transmembrane pressure (50 psig) at 30 °C, 5-35 L/min recirculation rate at 0.4 bar (6 psi) | parameter 3.5 bar max. transmembrane pressure (50 psig) at 30 °C, 5-35 L/min recirculation rate at 0.4 bar (6 psi) |
| manufacturer/tradename Pellicon® | manufacturer/tradename Pellicon® | manufacturer/tradename Pellicon® | manufacturer/tradename Pellicon® |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service