HLTUD001C
MISSION® Lenti microRNA Inhibitor
ath-miR416, Negative Control 1, Sequence from Arabidopsis thaliana with no homology to human and mouse gene sequences
Synonym(s):
Tough Decoy, TuD
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41106609
Concentration:
≥1x106 VP/ml (via p24 assay)
Mature sequence:
GGUUCGUACGUACACUGUUCA
Quality Level
product line
MISSION®
form
liquid
concentration
≥1x106 VP/ml (via p24 assay)
mature sequence
GGUUCGUACGUACACUGUUCA
Sanger mature/minor accession no.
Sanger microRNA accession no.
shipped in
dry ice
storage temp.
−70°C
General description
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other Notes
Based on miRBase V19 Mature ID
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Still not finding the right product?
Explore all of our products under MISSION® Lenti microRNA Inhibitor
Storage Class
12 - Non Combustible Liquids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hujun Cui et al.
Digestive diseases and sciences, 62(8), 1995-2003 (2017-04-24)
Esophageal squamous carcinoma (ESC) is one of the most fatal malignancies worldwide with increasing occurrences yet poor outcome. MicroRNAs were reported to play roles in ESC. We aimed to understand how miRNAs affect the radiotherapy resistance of ESC. MicroRNA assays
Davide Marangon et al.
Glia, 68(10), 2001-2014 (2020-03-13)
In the last decade, microRNAs have been increasingly recognized as key modulators of glial development. Recently, we identified miR-125a-3p as a new player in oligodendrocyte physiology, regulating in vitro differentiation of oligodendrocyte precursor cells (OPCs). Here, we show that miR-125a-3p
Jaira F de Vasconcellos et al.
Journal of translational medicine, 15(1), 169-169 (2017-08-05)
In humans, the heterochronic cascade composed of the RNA-binding protein LIN28 and its major target, the let-7 family of microRNAs (miRNAs), is highly regulated during human erythroid ontogeny. Additionally, down-regulation of the let-7 miRNAs in cultured adult CD34(+) cells or
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HLTUD001C | 04061836743918 |