HMI0021
MISSION® microRNA Mimic
hsa-let-7i
Synonym(s):
hsa-let-7i-5p
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
product line
MISSION®
form
solid
mature sequence
UGAGGUAGUAGUUUGUGCUGUU
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
—
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Biochem/physiol Actions
The miRNA hsa-let-7i-5p is associated with colorectal cancer metastasis. Its targets include TRIM41 (tripartite motif-containing protein 41), SOX13 (SRY (sex determining region Y)-box 13), SLC25A4 (solute carrier family 25 member 4), SEMA4F (semaphorin-4F), RPUSD2 (RNA pseudouridylate synthase domain-containing protein 2), PLEKHG6 (pleckstrin homology domain-containing family G member 6), CCND2 (G1/S-specific cyclin-D2) and BTBD3 (BTB/POZ domain-containing protein 3). It also targets TLR4 (toll like receptor) and can inhibit TLR4-mediated damage.
Other Notes
miRBase V18 Mature ID update: hsa-let-7i-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Comprehensive gene and microRNA expression profiling reveals the crucial role of hsa-let-7i and its target genes in colorectal cancer metastasis.
Zhang P
Molecular Biology Reports, 39, 1471-1471 (2012)
Hsa-mir-let 7i Treatment Suppresses Tlr4 Mediated Mitochondrial Oxidative Stress In Giant Cell Arteritis.
Rao NA and Saraswathy S
Investigative Ophthalmology & Visual Science, 53, 6243-6243 (2012)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI0021-5NMOL | 04061831380507 |