product line
MISSION®
form
solid
mature sequence
UAACACUGUCUGGUAACGAUGU
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
—
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Other Notes
miRBase V18 Mature ID update: hsa-miR-200a-3p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Vin Yee Chung et al.
Scientific reports, 6, 19943-19943 (2016-02-19)
Epithelial-mesenchymal transition (EMT), a biological process by which polarized epithelial cells convert into a mesenchymal phenotype, has been implicated to contribute to the molecular heterogeneity of epithelial ovarian cancer (EOC). Here we report that a transcription factor--Grainyhead-like 2 (GRHL2) maintains
Related Content
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service