HMI0364
MISSION® microRNA Mimic
hsa-miR-206
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
product line
MISSION®
form
solid
mature sequence
UGGAAUGUAAGGAAGUGUGUGG
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
—
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Amriti R Lulla et al.
Cancer research, 77(24), 6902-6913 (2017-10-25)
CDK4/6 targeting is a promising therapeutic strategy under development for various tumor types. In this study, we used computational methods and The Cancer Genome Atlas dataset analysis to identify novel miRNAs that target CDK4/6 and exhibit potential for therapeutic development
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI0364-5NMOL | 04061831382167 |