HMI0400
MISSION® microRNA Mimic
hsa-miR-222
Synonym(s):
hsa-miR-222-3p
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
product line
MISSION®
form
solid
mature sequence
AGCUACAUCUGGCUACUGGGU
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
—
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Application
MISSION® microRNA Mimic (hsa-miR-222) has been used to study the effect of specific miRNAs on macrophage-derived apoptotic bodies-mediated proliferation of the recipient epithelial cells.
Biochem/physiol Actions
The microRNA hsa-miR-222 (also referred to as hsa-miR-222-3p) targets SOCS3 (suppressor of cytokine signaling 3) and ZFPM2 (zinc finger protein). It is present in the ovarian cancer derived-exosomes and is proposed as a biomarker for diagnosis. Exosomal miR-222-3p is associated with the polarization of tumor-associated macrophages. Also, hsa-miR-222 is downregulated in the plasma of patients with ventricular septal defect.
Other Notes
miRBase V18 Mature ID update: hsa-miR-222-3p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Characterization of circulating microRNA expression in patients with a ventricular septal defect.
Li D, et al.
PLoS ONE, 9, e106318-e106318 (2014)
Epithelial ovarian cancer-secreted exosomal miR-222-3p induces polarization of tumor-associated macrophages.
Ying X
Oncotarget, 7, 43076-43076 (2016)
Ziwen Zhu et al.
Journal of leukocyte biology, 101(6), 1349-1359 (2017-03-10)
Bacterial pneumonia is a common and serious clinical entity. Alveolar epithelial cells and alveolar macrophages are the first line of defense in the innate immunity against bacterial pathogens. Epithelial cells are known to release chemokines/cytokines that recruit and activate phagocytic
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI0400-5NMOL | 04061831382426 |