HMI0454
MISSION® microRNA Mimic
hsa-miR-30a
Synonym(s):
hsa-miR-30a-5p
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
product line
MISSION®
form
solid
mature sequence
UGUAAACAUCCUCGACUGGAAG
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
—
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Other Notes
miRBase V18 Mature ID update: hsa-miR-30a-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Yuhao Zhang et al.
American journal of physiology. Lung cellular and molecular physiology, 316(1), L144-L156 (2018-11-02)
Premature male neonates are at a greater risk of developing bronchopulmonary dysplasia (BPD). The reasons underlying sexually dimorphic outcomes in premature neonates are not known. The role of miRNAs in mediating sex biases in BPD is understudied. Analysis of the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI0454-5NMOL | 04061831382761 |