HMI0903
MISSION® microRNA Mimic
hsa-miR-675
Synonym(s):
hsa-miR-675-5p
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
product line
MISSION®
form
solid
mature sequence
UGGUGCGGAGAGGGCCCACAGUG
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
human ... hsa-miR-675(100126270)
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Biochem/physiol Actions
The microRNA hsa-miR-675 (also referred to as hsa-miR-675-5p) is present in H19, a long non coding RNA. It is mainly involved in carcinogenesis. This miRNA is downregulated in non-small cell lung cancer (NSCLC) and is associated with tumor progression and development. It works as a tumor suppressor in NSCLC by targeting GPR55 (G-protein coupled receptor 55). The hsa-miR-675 is upregulated in colon cancer and helps in hypoxia-mediated epithelial to mesenchymal transition. It targets ZEB1 (zinc finger E-box-binding homeobox 1) at the post-transcriptional level and controls the progression of pancreatic cancer cells. It also has an oncogenic role in esophageal squamous cell carcinoma by targeting REPS2 (RalBP1-associated Eps domain-containing protein 2).
Other Notes
miRBase V18 Mature ID update: hsa-miR-675-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
13 - Non Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
The mir-675-5p regulates the progression and development of pancreatic cancer via the UBQLN1-ZEB1-mir200 axis.
Wang J
Oncotarget, 8, 24978-24987 (2017)
Down-regulation of miR-675-5p contributes to tumor progression and development by targeting pro-tumorigenic GPR55 in non-small cell lung cancer.
He D
Molecular Cancer, 14 (2015)
miR-675-5p enhances tumorigenesis and metastasis of esophageal squamous cell carcinoma by targeting REPS2.
Zhou YW
Oncotarget, 7, 30730-30747 (2016)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| HMI0903-5NMOL | 04061831384291 |