Skip to Content
Merck
CN

HUTR05730

Sigma-Aldrich

MISSION® 3′UTR Lenti GoClone

Powered by SwitchGear Genomics, 3′UTR, human, KIFC3

Synonym(s):

HUTR

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
12352200
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Functional Validation of miRNA Gene Targets

product line

MISSION®

concentration

≥1x105 VP/ml (via p24 assay)

human 3′UTR sequence

AGTGGACAAGAGGCTGATGATCTCATGCCCCTGCAGGGAAGTCGCGGCCACTGCCTGTGTGACGGATGTGACCCCGCTGGGCCTGAAGCTGGGCCCTCACTGGCCTGTCCCTGCTGCAGCGCCAGGACCCCCGGAGGTAGAGGCGAGAGTGGAGGCTCTTCTTCTGCCCCGTCTCCCCTCAAAGATGAGAAACATGTTCAGAAGGAAACGGTGTCTCTCGGCTGTGGCTCTGAGTGCAAATTGCATGGGCGGAAA (3′UTR sequences are truncated after the first 255 bases)

NCBI accession no.

shipped in

dry ice

storage temp.

−70°C

Gene Information

human ... KIFC3(3801)

Application

To see more application data, protocols, and vector maps visit www.sigma.com/3utr.

Physical form

200 μL of at least 105 VP/mL (via p24 titering assay) lentiviral particles are provided as frozen stock.

Legal Information

Use of this product is subject to one or more license agreements. For details, please see www.sigmaaldrich.com/missionlicense.
GoClone is a trademark of SwitchGear Genomics
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
SwitchGear Genomics is a trademark of SwitchGear Genomics

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service