HUTR11631
MISSION® 3′UTR Lenti GoClone™
Powered by SwitchGear Genomics™, 3′UTR, human, PDS5A
Synonym(s):
HUTR
Select a Size
About This Item
description
Functional Validation of miRNA Gene Targets
product line
MISSION®
concentration
≥1x105 VP/ml (via p24 assay)
human 3′UTR sequence
TCCACATCTTTTCTAACTTTGCGTTCTATTCTTAACCCTAAGGTAAAAATGCATTTGCAAAGGGAGAAAATGAAGGCCAAACAGAAGCAGGCTCCAGCTTCTGCAAAAACTTGGATTCACAAATGTCCCTGAACAGAAAATGAAGCTCACTTCAGAACACACACTCTCTGCCTTGAAAACTAAAGAGACTATTACTTCCTTTTCACATGACCACAAGTCCTCTGATGGAAATGTACAGCAGAAACTCTTGAGAGA (3′UTR sequences are truncated after the first 255 bases)
NCBI accession no.
shipped in
dry ice
storage temp.
−70°C
Gene Information
human ... PDS5A(23244)
Application
Physical form
Legal Information
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service