Skip to Content
Merck
CN

MLMIR0348

Sigma-Aldrich

MISSION® Lenti microRNA, Mouse

mmu-miR-211-3p

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41106609
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

product line

MISSION®

form

liquid

concentration

≥1x106 VP/ml (via p24 assay)

mature sequence

GCAAGGACAGCAAAGGGGGGC

Sanger mature/minor accession no.

Sanger microRNA accession no.

shipped in

dry ice

storage temp.

−70°C

General description

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Other Notes

Based on miRBase V20 Mature ID
Two negative controls are available: NCLMIR001 and NCLMIR002

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service