Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41106609
Concentration:
≥1x106 VP/ml (via p24 assay)
Mature sequence:
CGGCGCCCCACGGAGCCCCGAGC
product line
MISSION®
form
liquid
concentration
≥1x106 VP/ml (via p24 assay)
mature sequence
CGGCGCCCCACGGAGCCCCGAGC
Sanger mature/minor accession no.
Sanger microRNA accession no.
shipped in
dry ice
storage temp.
−70°C
General description
Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Other Notes
Based on miRBase V20 Mature ID
Two negative controls are available: NCLMIR001 and NCLMIR002
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| MLMIR1232 | 04061836718510 |
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service