Merck
CN
Search Within
文件类型

67-07-2

应用筛选条件
关键词:'67-07-2'
显示 31-60 共 169 条结果 关于 "67-07-2" 范围 技术文档
Data Sheet - G0296
concentrations by titration test. References 1. Pitcher, J.A., et al., Ann. Rev. Biochem., 67, 653- 692 (1998). 2. Penela, P., et al., Cell Signal., 15, 973-981 (2003). 3. Ren, X-R., et al., Proc. Natl.
Data Sheet - T8194
T8194.dat Anti-phospho Tau _pThr181_ AH,PHC 07-05-1.doc Anti-phospho-Tau (pThr181) Developed in Rabbit, Affinity Isolated Antibody Catalog Number T 8194 Product Description Anti-phospho-Tau
Data Sheet - SAB4200598
4587 (2008). 2. Treffry, A., et al., FEBS Lett., 302, 108-112 (1992). 3. Oppenheim, E.W., et al., J. Biol. Chem., 276, 19855-19861 (2001). 4. Tang, D.C., Nat. Clin. Pract. Nephrol., 5, 66-67 (2009)
Product Information Sheet - H5659
chemical reaction with L-histidine. Biochim. Biophys. Acta, 1537(1), 27-41 (2001). GCY/RXR 3/07 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich, Inc. warrants that
SMC®Plate Washer Evaluation Kit
Column Mean 78 65 72 63 69 67 65 63 64 73 61 81 SD 10 9 11 12 6 10 12 10 11 11 10 5 CV 12 13 16 19 8 16 19 15 17 15
10- Plex RTK Angiogenesis Total Protein Magnetic Bead Panel
VEGFR3 33 MCSFR 39 TIE2 44 TIE1 52 PDGFRβ 64 FLT3 66 PDGFRα 67 48-673MAG Rev. 07-JUN-2012
Impurities & Related Compounds: Reference Materials
107-06-2 107-06-2 123-91-1 123-91-1 71-36-3 71-36-3 71-41-0 71-23-8 78-92-2 110-80-5 109-86-4 78-83-1 67-63-0 67-63-0 123-51-3 75-07-0 75-07-0 64-19
Data Sheet - A4856
Hawley, S.A, et al., J. Biol., 2, 28 (2003). 7. Woods, A., et al., Curr. Biol., 13, 2004-2008 (2003). 8. Warden, S.M., et al., Biochem. J., 354, 275-283 (2001). CS,PHC 11/07-1 Sigma brand products are
Data Sheet - F3165
reduce background and cross-reactivity. See the Troubleshooting Guide. F3165dat Rev 07/21 2 7. Remove the Monoclonal ANTI-FLAG® M2 solution, and wash once with at least 0.5 mL/cm2 of
Specialty Materials For Dental Applications Brochure
methacrylate Monomer; adhesive promoter 17096-07-0 2-(Trimethylsilyloxy) ethyl methacrylate Monomer; adhesive promoter 17407-09-9 Bis (2-(methacryloyloxy) ethyl) phosphate Monomer
Protocol: Feline Cytokine/Chemokine Magnetic Bead Panel
Standard 3 200 µL 100 µL of Std 4 Standard 2 200 µL 100 µL of Std 3 Standard 1 200 µL 100 µL of Std 2 FCYTMAG-20K-PMX
Data Sheet - PP0600
exoglycosidases for structural studies of glycoconjugates. Anal. Biochem., 100, 1-14, (1979). AE,NA,MAM 09/07-1 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich, Inc. warrants that its
User Guide - B3111
B3111 http://www.SigmaAldrich.com http://www.SigmaAldrich.com B3111PISw Rev 07/20 2 of 2 The life science business of Merck operates as MilliporeSigma in the U.S.
(I8658) - Enzyme Assay
Anti-Interleukin-22 antibody produced in goat (I8658) - Enzyme Assay L8658 Page 1 of 3 SPYEAS01 Revised: 07/30/96 SIGMA QUALITY CONTROL TEST PROCEDURE Enzymatic Assay of LYTICASE PRINCIPLE: Yeast
(L8658) - Enzyme Assay
Lyticase from Arthrobacter luteus (L8658) - Enzyme Assay L8658 Page 1 of 3 SPYEAS01 Revised: 07/30/96 SIGMA QUALITY CONTROL TEST PROCEDURE Enzymatic Assay of LYTICASE PRINCIPLE: Yeast
(L4276) - Enzyme Assay
Lyticase from Escherichia coli (L4276) - Enzyme Assay L4276 Page 1 of 3 SPYEAS01 Revised: 07/30/96 SIGMA QUALITY CONTROL TEST PROCEDURE Enzymatic Assay of LYTICASE PRINCIPLE: Yeast
PureFlex™ and PureFlex™ Plus White Paper
PureFlex™ water no acetone 67-64-1 10.0 Acetaldehyde (TIC) 75-07-0 51 water yes acetone 67-64-1 75 tert-butyl alcohol 75-65-0 64 2-butanone 78-93-3 29 acetaldehyde (TIC) 75-07-0 188 Butanal (TIC) 123
Product Information Sheet - L1376
, NY: 1986), pp. 176-177. 2. The Merck Index, 12th ed., Entry# 5529. 3. Oil crops of the world, Robbelen, G., et al., eds., McGraw-Hill (New York: 1989), pp. 66-67. 4. Boyd, et al., A rapid
Product Information Sheet - P6224
Autoxidation of polysorbates. J. Pharm. Sci., 67, 1676-1681 (1978). TWEEN is a registered trademark of Uniqema, a business unit of ICI Americas Inc. RLG 9/07 Sigma brand products are
Data Sheet - G4291
dilutions by titration test. References 1. Kerr, D.I. and Ong, J., Pharmacol. Ther., 67, 187- 246 (1995). 2. Kostowski, W., Pol. J. Pharmacol., 47, 237-246 (1995). 3. Whiting, P.J. et al., Ann.
KiCqStart SYBR Green Primers Gene Arrays Safety Data Sheet
- 2007-07-01 Pennsylvania Right To Know Components CAS-No. - Revision Date Non hazardous component(s) liquid - Glycerol 56-81-5 2007-03-01 Dimethyl sulfoxide 67-68-5 2007
Data Sheet - P1435
to the cell wall of potato tubers. Agric. Biol. Chem., 45, 1767-73 (1981). KAD,RBG,JWM,MAM 12/07-1 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich, Inc. warrants that its
Data Sheet - T6944
97, 221-230 (1999). 14. Wang, J.Z., et al., Mol. Brain Res., 38, 200-208 (1996). KAA,PHC 11/07-1 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich, Inc. warrants that its
Data Sheet - CLLS1010
[cp17] (from NCBI SKY/M-FISH database) 2 Figure 1b. Site-specific deletion at the SMAD4 Locus in SW48 cell line Alleles 1 and 2 – 67 bp deletion: CTGATAGGCCATGGGTGAGTTACACTTTTTGCCCA
Product Information Sheet - D5758
6. The Merck Index, 12th Ed., Entry# 8182, p. 1375 (1996). 7. Berger, S.L., Anal. Biochem., 67(2), 428-437 (1975). 8. Data For Biochemical Research, 3rd Edition (Dawson, R.M.C., et al., eds
Data Sheet - G4519
(1983). 2. Varani, J. et al., Journal of Biological Standardization, 13, 67-76 (1985). Sigmacote is a trademark of Sigma-Aldrich Biotechnology LP and Sigma-Aldrich Co. GS,MAM 11/07-1 Sigma
Data Sheet - G2892
(1983). 2. Varani, J. et al., Journal of Biological Standardization, 13, 67-76 (1985). Sigmacote is a trademark of Sigma-Aldrich Biotechnology LP and Sigma-Aldrich Co. GS,MAM 11/07-1 Sigma
Data Sheet - G2517
(1983). 2. Varani, J. et al., Journal of Biological Standardization, 13, 67-76 (1985). Sigmacote is a trademark of Sigma-Aldrich Biotechnology LP and Sigma-Aldrich Co. GS,MAM 11/07-1 Sigma
NovAseptic®Mixer, Drive Unit, GMP
of Millipore AB. Specifications subject to change without notice. Lit. No. SP5229EN00 Rev. A 07/2014 PS-13-08217 ©2014 EMD Millipore Corporation, Billerica, MA 01821 U.S.A. All rights reserved
Product Information Sheet - NXTRACT
(Component I5402): 10% IGEPAL® CA-630 in deionized water NXTRACTpis Rev 07/23 2
2/6