695-56-7 | Sigma-Aldrich

Data Sheet - SRP5167

BCR (1-695) (SRP5167) - Datasheet BCR (1-695), GST-tagged, human recombinant, expressed in Sf9 insect cells Catalog Number SRP5167 Storage Temperature –70 °C Synonyms: ALL, CML, PHL, BCR1

Data Sheet - C6455 - Lot 046K8803

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 103K8800

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)- 2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 055K8804

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 16H5955

Storage Temperature: 2 - 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)- 2-(4-nitrophenyl)ethyl]-, [

Data Sheet - C6455 - Lot 067K5014

Reference Standard Catalog Number C6455 Lot Number 067K5014 Storage Temperature 2–8 °C CAS RN 56-75-7 Synonyms: D-threo-(-)-2,2-Dichloro-N-[β-hydroxy- α-(hydroxymethyl)-p-nitropenethyl]Acetamide; Acetamide

Data Sheet - C6455 - Lot 102K8802

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)- 2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 086K8803

Reference Standard Product Number C6455 Lot Number 086K8803 Storage Temperature 2–8 °C CAS RN 56-75-7 Synonyms: D-threo-(–)-2,2-Dichloro-N-[β-hydroxy- α-(hydroxymethyl)-p-nitrophenethyl]acetamide; Acetamide

Data Sheet - A8717

synthetic peptide KMQQNGYENPTYKFFEQMQN corresponding to the C-terminal of human APP695 (amino acids 676-695) conjugated to KLH. This sequence is identical in rat and mouse APP695 and the isoforms APP751 and

Data Sheet - SAB4200816

et al., Eur. J. Immunol., 22, 2513-7 (1992). 11. Clipstone, N., and Crabtree, G., Nature, 357, 695-7 (1992). 12. Yamasaki, Y. et al., Neuroscience, 49, 545-56 (1992). 13. Tůmová, L. et al.

Quality Control Range Sheet- A6041-103 and A6041-203

Control 1 69 - 143 pg/mL Control 2 636 - 1320 pg/mL Control 2 335 - 695 pg/mL IL-17A Control 1 26 - 55

Product Information Sheet - O8801

Tomalia, J.D. DeVrieze, and R.J. Dolinski, Am. Chem. Soc., Div. Org. Coat. Plast. Chem., Pap., 34, 695 (1974); Chem Abstr., 84, 60292r (1976). 34 F. Seela and W. Wesemann, Z. Naturforsch., Teil. C

XP725 Antibody Number-Lot Number 071M4826

c-d e-f g-h a-b c-d e-f g-h 1.1 1 2 3 4 25 26 27 28 49 50 51 52 73 74 75 76 1.2 5 6 7 8 29 30 31 32 53 54 55 56 77 78 79

Glycobiology Brochure

00 81 Tel: (+41) 81 755 2511 Fax: (+41) 81 756 5449 Taiwan SAFC Hitech Tel: (+886) 7 695 5066 Fax: (+886) 7 695 5088 Thailand Tel: (+66) 2 126 8141 Fax: (+66) 2 126 8080 United Kingdom Free Tel

Product Information Sheet - INHIB1

3977-3983 (1982). 54. Alexander, N.M., Anal. Chem., 30(7), 1292-1294 (1958). 55. Knight, C.G., Biochem. J., 189(3), 447-453 (1980). 56. Zollner, H., Handbook of Enzyme Inhibitors (2 nd

Product Information Sheet - BE0100

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

BE0100-Amyloid 1-40 ELISA Human AHPHC

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

BE0200-Amyloid 1-42 ELISA Human AHPHC

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

Product Information Sheet - BE0200

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

XP725 Antibody List Lot 129K4831

BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/

XP725 Antibody List Lot 129K4830

BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/

XP725 Antibody List Lot 089K4791

BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/

Imprint Ultra Chromatin Immunoprecipitation Kit User Guide

Primer Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC

XP725 Antibody List

SMARCA4,Smarca4 NP_003063.2,NP_035547.2 P y n/d n/d 79 BTK, C-Terminal B0811 695 BTK NP_000052.1 P y n/d n/d 80 BTK, N-Terminal B0686 695 BTK NP_000052.1 P y n/d n/d 81 BUB1 B0561 699 BUB1 NP_004327.1 M y n/d

XP725 Antibody List 013M4793

SMARCA4,Smarca4 NP_003063.2,NP_035547.2 P y n/d n/d 79 BTK, C-Terminal B0811 695 BTK NP_000052.1 P y n/d n/d 80 BTK, N-Terminal B0686 695 BTK NP_000052.1 P y n/d n/d 81 BUB1 B0561 699 BUB1 NP_004327.1 M y n/d

Organic and Molecular Electronics

Student Advanced technical paper, 1989, Nippon Kogyo Shinbun (7) Tessler, N.; Denton, G. J.; Friend, R. H. Nature 1996, 382, 695-697. (8) Frolov, S. V.; Ozaki, M.; Gellermann, W.; Vardeny, Z. V.

XP725 Worksheet for Lot Number 071M4826

SIGMA� http://www.sigmaaldrich.com/ProductLookup.html?ProdNo=H7412&Brand=SIGMA� p 695 4 3 3 7 Heat Shock Protein 110 H7287 696 4 3 3 8 Heat Shock Protein 110 H7287 697 4 3 4 1 Acetyl Histone

List of Antibodies

692 Survivin S8191 P y n/d n/d 693 Synaptotagmin S2177 P y y n/d 694 Synaptopodin S9442 P n/d n/d y 695 Synaptopodin S9567 P n/d n/d y 696 Anti Cy3+Cy5 C0992 M NA NA NA 697 SynCAM S4945 P n/d y y 698 α1

Halal Certificate

Natural W253006 C32921 HC-23SIQM44 694. GUAIACOL NATURAL, 98%, FG W253200 A46856 HC-23SI5S57 695. Guaiacyl Phenyl Acetate W253502 C32922 HC-23SIYU12 696. GUAICWOOD ACETATE W522007 B26968 HC-23SICK41

Halal Certificate

Natural W253006 C32921 HC-22SIZL65 694. GUAIACOL NATURAL, 98%, FG W253200 A46856 HC-22SIET78 695. Guaiacyl Phenyl Acetate W253502 C32922 HC-22SI5R33 696. GUAICWOOD ACETATE W522007 B26968 HC-22SI4362