CN
200-876-6
应用筛选条件
关键词:'200-876-6'
显示 1-30 共 33 条结果 关于 "200-876-6" 范围 技术文档
Product Information Sheet-lldh-ro
: 09
Content Version: November 2021
Cat. No. 10 127 230 001 10 mg
2 ml
Cat. No. 10 127 876 001 25 mg
5 ml
Cat. No. 10 127 884 001 100 mg
10
Product Information Sheet-pefbsc-ro
December 2020
Cat. No. 11 429 868 001 100 mg
Cat. No. 11 585 916 001 500 mg
Cat. No. 11 429 876 001 1 g
Store the product at +2 to +8°C.
Evaluating the Impact of Various Parameters on NovaSeptum®Sterile Sampling Flow Rate
) Flow rate (mL/min)
192 0.02 2
111 0.02 4
58 0.02 6
31 0.02 9
24 0.02 14
16 0.02 22
1 0.02 114
876 0.1 1
192 0.1 6
Data Sheet - M8322 - Lot 039K0769
located in the small cell lung cancer tumor
suppressor gene region. Molec. Cell. Biol., 16, 868-
876 (1996).
2. Ludwig, S. et al., 3pK, a novel mitogen-activated
protein (MAP) kinase-activated protein
Data Sheet - M8322 - Lot 019K1619
located in the small cell lung cancer tumor
suppressor gene region. Molec. Cell. Biol., 16, 868-
876 (1996).
2. Ludwig, S. et al., 3pK, a novel mitogen-activated
protein (MAP) kinase-activated protein
Human Oligodendrocyte Characterization Kit
anti-PLP/DM20 antibody, 100 μg (Cat. No. MAB388-100UG)
6. Mouse anti-MOG antibody, 100 μg (Cat. No. MAB5680)
7. Mouse anti-MAP2 antibody, 200 μg (Cat. No. MAB3418)
8. Mouse anti-GFAP antibody
Product Information Sheet - T7701
Wild-type C.
perfringens
Mutant plc
targetron
plc-F
plc-R
200 bp 1.1 kb
plc-F
Intron
Specific
No product 876 bp
plc-50/51a target sequence
TAGACTTTAGTTGATGCCCCAGCCCATAGG -
intron
Product Information Sheet - MTOX1000P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - MTOX1000CC24
Compound Stock Solution: Dissolve
compound at 200 concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 C.
•
Product Information Sheet - MTOX1003P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - MTOX1006P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - MTOX1004P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - MTOX1005P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - MTOX1002P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - MTOX1001P24
Compound Stock Solution: Dissolve
compound at 200× concentration in DMSO and
vortex to mix. If necessary, warm or sonicate to
dissolve completely. Store up to 6 months
at 2–8 °C.
• Test Compound Working
Product Information Sheet - 4719948001
inhibitory units 10 602 442 001
Pefabloc® SC 100 mg
500 mg
1 g
11 429 868 001
11 585 916 001
11 429 876 001
Pepstatin 2 mg
10 mg
50 mg
10 253 286 001
11 359 053 001
11 524 488
Product Information Sheet - P3623
Quantification of
Differential Protein Complex Composition. Rapid
Commun. Mass Spectrom., 18, 869-876 (2004).
8. Stewart, I.I. et al., 18O Labeling: A Tool for
Proteomics., Rapid Commun. Mass Spectrom
inNovations Newsletter #13
University Medical School, Chicago IL 60611
1–876 1–341
Nano Juice™ Transfection Kit
International
Phone 800 932 5000
Web www.vwr.com
Printed in the USA
$37
$49
$63
$200
$876
$54
$97
$173
$36
$119
$239
$36
$119
$34
$59
$51
User Guide - AL0103000
ALiCE® Tube caps,
perforated
6 n/a n/a Room temp.
Midi-Kit (6 x 200 µL ALiCE®)
Component Quantity Concentration Volume Storage
ALiCE® reaction mix 6 n/a 200 µL -80 °C
Product Information Sheet - MDRQ1
Inhibitor 2 solution to
each of tubes 4-6. Mix well by gentle agitation,
avoid bubbles. Incubate all 9 tubes at 37 °C for
5 minutes.
5. Following incubation, add 200 µl of MDR
Fluorescent Cytoplasmic
Glycobiology Brochure
PP0530-1KT Components
2-AA (Anthranilic acid) 2 × 6 mg
DMSO 2 × 350 μl
Acetic acid, glacial 2 × 200 μl
Reductant (sodium cyanoborohydride)
2 × 6 mg
1 kit
GlycoProfi le 2-AB Labeling Kit
Cat. No
Apoptosis - Antibodies, Reagents and Kits
µL 07-877 $309
Anti-phospho-PKCη (Ser674) H WB Rb IgG 100 µL 07-876 $309
36
PKCζ
Anti-PKCζ H M R WB Rb IgG 200 µL 07-264 $309
Product Information Sheet - 11719386001
529 048 001
Pefabloc SC (AEBSF) 100 mg
500 mg
1 g
11 429 868 001
11 585 916 001
11 429 876 001
Pepstatin 2 mg
10 mg
50 mg
10 253
Product Information Sheet - 11719394001
529 048 001
Pefabloc SC (AEBSF) 100 mg
500 mg
1 g
11 429 868 001
11 585 916 001
11 429 876 001
Pepstatin 2 mg
10 mg
50 mg
10 253
MultiDrugQuant Assay Kit - Data Sheet
µL Inhibitor 2 into tubes # 4-6.
Mix thoroughly with gentle pipetting. Avoid bubbling. Incubate all nine
tubes for 5 min at 37 °C.
20. To begin the reaction, add 200 µL of calcein AM solution prepared
MILLIPLEX®MAP Human Myokine Panel is an optimized quantitative immunoassay that simultaneously measures 15 novel muscle-secreted factors
Dog 1 862 11409 163 36 449
Dog 2 1244 100 7110 36 239
Dog 3 443 2890 6 31 171
Dog 4 12413 8 768 33 394
Rabbit 1 876 44 6110 317 17725
Sonic Hedgehog Research Focus - Volume 3, 2012
14. Reinferberger, J., et al. Cancer Res. 1998; 58:1798.
15. Dahmane, N., et al. Nature 1997;389: 876.
16. Oro. A., et al. Science 1997; 276: 817.
http://www.merckmillipore.com/techservice
http
Calbiochem Biologics 29.4
≥97% by HPLC.
Cat. No. 217697 1 mg
5 mg
Ref.: Brachwitz, K., et al. 2003. J. Med. Chem. 46, 876.
Cdk Inhibitor, p35
An analog of Olomoucine
(Cat. No. 495620) that acts as a
potent inhibitor of
Bioreagents for DNA/RNA Electrophoresis
unit
12 · 103 0.75 Z33,963-6
1.0 Z33,964-4
2.0 Z33,966-0
For standard vertical unit
20 · 200 0.75 Z33,990-3
1.0 Z33,991-1
1.5 Z33,993-8
2.0 Z33,994-6
3.0 Z33,995-4
Replacement
1/2