Merck
CN
Search Within
文件类型

619-66-9

应用筛选条件
关键词:'619-66-9'
显示 31-60 共 64 条结果 关于 "619-66-9" 范围 技术文档
Product Information Sheet - L5004
Immunol. Methods, 70, 167- 177 (1984). 26. Khidir, M.A. et al., Experimental Cell Research, 219, 619-625 (1995). 27. Fisher, A.N. et al., International J. of Pharmaceutics, 74, 147-156 (1991).
Product Information Sheet - L4129
Immunol. Methods, 70, 167- 177 (1984). 26. Khidir, M.A. et al., Experimental Cell Research, 219, 619-625 (1995). 27. Fisher, A.N. et al., International J. of Pharmaceutics, 74, 147-156 (1991). 28.
Product Information Sheet - L6629
Immunol. Methods, 70, 167- 177 (1984). 26. Khidir, M.A. et al., Experimental Cell Research, 219, 619-625 (1995). 27. Fisher, A.N. et al., International J. of Pharmaceutics, 74, 147-156 (1991).
Product Information Sheet - L1381
Immunol. Methods, 70, 167- 177 (1984). 26. Khidir, M.A. et al., Experimental Cell Research, 219, 619-625 (1995). 27. Fisher, A.N. et al., International J. of Pharmaceutics, 74, 147-156 (1991).
Product Information Sheet - L2131
Immunol. Methods, 70, 167- 177 (1984). 26. Khidir, M.A. et al., Experimental Cell Research, 219, 619-625 (1995). 27. Fisher, A.N. et al., International J. of Pharmaceutics, 74, 147-156 (1991).
Product Information Sheet - L4149
Immunol. Methods, 70, 167- 177 (1984). 26. Khidir, M.A. et al., Experimental Cell Research, 219, 619-625 (1995). 27. Fisher, A.N. et al., International J. of Pharmaceutics, 74, 147-156 (1991).
Product Information Sheet - PP0301
et al., Anal. Chem., 66, 2062- 2070 (1994). 5. Smith, R.D., et al., Anal. Chem., 62, 882-899 (1990). 6. Harvey, D.H., et al., Rapid Commun. Mass Spectrom., 7, 614-619 (1993). Related
Evaluation of Intracellular Signaling - Downstream Chimeric Antigen Receptors
36. Smith-Garvin JE, Koretzky GA, Jordan MS. T cell activation. Annu Rev Immunol. 2009; 27:591–619. Epub 2009/01/10. doi: 10.1146/annurev.immunol.021908.132706 [pii]. PMID: 19132916; PubMed Central
Antibodies to Cancer Biomarkers
-L at and around the c-terminus. 04-1061 Rabbit This antibody recognizes phosphorylated Ser614/619 of neurofilament M.ABN76 Rabbit MAB5256 Mouse The antibody reacts with neurofilament 200 kD.
Tools and Tips for Analyzing Apoptosis: A Kit Selection Guide
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Traditional Eastern Medication Application guide
notoginseng dissolved in methanol. Pressure Drop: 43 Bar (619 psi) 150 70 110 te ns it y (m AU ) -10 30 0 1 2 3 4 5 6 7 8 9
Traditional Eastern Application Guide
notoginseng dissolved in methanol. Pressure Drop: 43 Bar (619 psi) 150 70 110 te ns it y (m AU ) -10 30 0 1 2 3 4 5 6 7 8 9
Building blocks for peptide synthesis
J. S. Davies (2003) J. Pept. Sci., 9, 471. 6 J. Offer, et al. (1996) J. Chem. Soc., Perkin Trans. I, 175. 65. D. Delforge, et al. (1996) Lett. Pept. Sci., 3, 89. 66. M. Quibell, et al. (1994) J. Chem.
BRAND Katalog EN
max. Ø mm Height mm Cat. No. 5 23 34 619 50 10 23 52 619 55 30 37 53 619 60 60 37 92 619 65 90 57 62 619 70
Tools and Tips for Analyzing Apoptosis
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Antibody SourceBook, Sixth Edition, DIST version
N-Terminal (53-66) Rabbit pAb IB, IP rat 5395�6 100 µl €38� Anti-Protein Phosphatase 2A/C (298-309) Rabbit pAb IB, IC mammalian 539525 100 µl €�09 Anti-Protein Phosphatase 2Ba (�82-�9�) Rabbit pAb
Antibody Sourcebookル Sixth Edition
Anti-DFF45 (21-��) Rabbit pAb IB; NOT PS human, mouse PC�66 100 µg €294 Anti-Dipeptidylpeptidase IV Rabbit pAb FS, IB, IP human IM1004 100 µl €��9 Anti-DNA Methyltransferase �a (86-100) Rabbit pAb IB
Imprint Ultra Chromatin Immunoprecipitation Kit User Guide
Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC
Brochure: Chromolith® Monolithic Silica HPLC Columns for small and large molecule separation
Pressure drop: 43 Bar (619 psi) Detection: UV 250 nm No Compound Retention Time (min) 1 Puerarin 3.0 Retention Time (minutes) -10 30 70 110 150 0 1 2 3
3D BIOPRINTING: Printing a Brighter Future
.; Ren, B.; Yuan, G.; Jia, Y.; Li, J.; Xiong, D.; Xing, X.; Niu, X. Mater. Sci. Eng. C 2019, 101, 619–629. (157) Gao, T.; Gillispie, G. J.; Copus, J. S.; Pr, A. K.; Seol, Y.-J.; Atala, A.; Yoo
XP725 Antibody List Lot 129K4831
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
XP725 Antibody List Lot 129K4830
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
3D BIOPRINTING: Printing a Brighter Future
.; Ren, B.; Yuan, G.; Jia, Y.; Li, J.; Xiong, D.; Xing, X.; Niu, X. Mater. Sci. Eng. C 2019, 101, 619–629. (157) Gao, T.; Gillispie, G. J.; Copus, J. S.; Pr, A. K.; Seol, Y.-J.; Atala, A.; Yoo
XP725 Antibody List Lot 089K4791
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
XP725 Antibody List
http://www.sigmaaldrich.com/ProductLookup.html?ProdNo=G7670&Brand=SIGMA� 3 9 3 9 3 9 3 9 3 9 3 9 3 9 T 3 3 9 3 9 334 HDAC-7 H6663 56233, 51564 HDAC7A,Hdac7a NP_062518.2,NP_057680.3 M y y n/d
List of Antibodies
bbc3, C-Terminal P4618 P y y n/d 617 PUMA/bbc3, N-Terminal P4743 P y n/d n/d 618 Pyk2 P3902 P y y y 619 AP2 beta P7114 M y n/d n/d 620 phospho-Pyk2 (pTyr579/580) P6989 P y n/d n/d 621 AP2 alpha P6739 M y
MultiScreen® and Millicell® Filter Plates for Assay Development
CV = (SD/mean)*100. 1 2 3 4 A 599 601 649 605 B 509 649 631 598 C 584 607 609 618 D 619 550 605 625 C. Spot number by well location
XP725 Antibody List 013M4793
n/d n/d 618 Pyk2 P3902 50646, 2185, 19229 Ptk2b,PTK2B NP_059014.2,NP_775268.1,NP_766086.1 P y y y 619 phospho-Pyk2 (pTyr579) P7114 50646, 2185 Ptk2b,PTK2B NP_059014.2,NP_775268.1 P y n/d y 620 phospho-
Halal Certificate
that time. Page 54 of 99 Product Name Product Code Halal-ID Product Certificate # 619. ETHYL PYRUVATE, =97%, FG W245735 B75829 HC-22SIA394 620. ETHYL SALICYLATE 99%, FCC, FG W245801
Halal Certificate
that time. Page 54 of 99 Product Name Product Code Halal-ID Product Certificate # 619. ETHYL PYRUVATE, =97%, FG W245735 B75829 HC-23SI6P73 620. ETHYL SALICYLATE 99%, FCC, FG W245801
2/3