Merck
CN
Search Within
文件类型

619-72-7

应用筛选条件
关键词:'619-72-7'
显示 1-30 共 41 条结果 关于 "619-72-7" 范围 技术文档
Data Sheet - 39573
Isolates from Patients with cystic fibrosis and use of a simple new selective medium. J. Clin. 35:3:614-619 Microbiol. (1997) 5. D.A. Henry, M.E. Campell, C. McGimpsey, A. Clarke, L. Louden, J.L. Burns
Data Sheet - I7026
factor- binding proteins (IGFBPs) and their regulatory dynamics, Int. J. Biochem. Cell Biol., 28, 619-637 (1996). 3. Jones, J.I., and Clemmons, D.R., Insulin-like growth factors and their binding
XP725 Antibody Number-Lot Number 071M4826
660 7.4 589 590 591 592 613 614 615 616 637 638 639 640 661 662 663 664 7.5 593 594 595 596 617 618 619 620 641 642 643 644 665 666 667 668 7.6 597 598 599 600 621 622 623
Product Information Sheet - L0906
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L3010
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L3013
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L1881
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L3135
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L5629
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L5257
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L5254
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L4149
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L1381
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L4129
micelles with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L6629
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L5004
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Product Information Sheet - L2131
with Stokes radius of 34 angstroms between 7 and 50 micromolar.9 At approximately 50 micromolar, a transition occurs to a larger size micelle with a 72 angstrom Stokes radius.9 The average aggregation
Hepatotoxicity Assay, Human HepG2 Cells
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Giuliano KA. Optimizing the integration of immunoreagents and fluorescent probes
FlowCellect™ Human T Cell Activation Kit (100 Tests)
1. Smith-Garvin JE, Koretzky GA, Jordan MS. T cell activation. Annu Rev Immunol. 2009;27:591- 619. 2. Biselli R, Matricardi PM, D'Amelio R, Fattorossi A. Multiparametric flow cytometric analysis
Traditional Eastern Medication Application guide
notoginseng dissolved in methanol. Pressure Drop: 43 Bar (619 psi) 150 70 110 te ns it y (m AU ) -10 30 0 1 2 3 4 5 6 7 8 9
Traditional Eastern Application Guide
notoginseng dissolved in methanol. Pressure Drop: 43 Bar (619 psi) 150 70 110 te ns it y (m AU ) -10 30 0 1 2 3 4 5 6 7 8 9
Tools and Tips for Analyzing Apoptosis: A Kit Selection Guide
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Building blocks for peptide synthesis
1993) J. Am. Chem. Soc., 115, 1138 72. A. Otaka, et al. (1991) Tetrahedron Lett., 32, 1223. 73. A. Cuthbertson & B. Indrevoll (2000) Tetrahedron Lett., 41, 3661. 7 M. Yoshida, et al. (1990) Chem. Pharm
Evaluation of Intracellular Signaling - Downstream Chimeric Antigen Receptors
xenograft models of adoptive immunotherapy. Cytotherapy. 2014; 16(5):619–30. Epub 2014/01/21. doi: 10.1016/j.jcyt.2013.10.013S1465-3249(13)00759-7 [pii]. PMID: 24439255; PubMed Central PMCID: PMC3988256. 48
Tools and Tips for Analyzing Apoptosis
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Drug Discovery Products & Services - Volume 1, 2014
HePTP 14-593 3 Lambda Protein Phosphatase 14-405 Lambda Protein Phosphatase, GST 14-598 LMPTP-A 14-619 3 LMPTP-B 14-620 3 MKP-1/CL100, active 14-391 MKP5, active 14-779 3 PP1, purified 14-110 PP1α 14-595
BRAND Katalog EN
max. Ø mm Height mm Cat. No. 5 23 34 619 50 10 23 52 619 55 30 37 53 619 60 60 37 92 619 65 90 57 62 619 70
Brochure: Chromolith® Monolithic Silica HPLC Columns for small and large molecule separation
Pressure drop: 43 Bar (619 psi) Detection: UV 250 nm No Compound Retention Time (min) 1 Puerarin 3.0 Retention Time (minutes) -10 30 70 110 150 0 1 2 3
Antibody SourceBook, Sixth Edition, DIST version
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Imprint Ultra Chromatin Immunoprecipitation Kit User Guide
Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC
1/2