Merck
CN
Search Within
文件类型

619-80-7

应用筛选条件
关键词:'619-80-7'
显示 31-60 共 71 条结果 关于 "619-80-7" 范围 技术文档
Bulletin - NA0400S
Nucleic Acids Res., 1979, 7, 1513–1522. 2. Vogelstein, B.; Gillespie, D. Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 1979, 76, 615–619. 8
Unlocking the Mystery of Cancer: Do the Mutant p110α Subunits of PI3-Kinase Hold the Key?
17, 743-753 6. Cantley, L.C. Science 2002, 296, 1655-1657 7. Engelman, J.A.; Luo, J.; Cantley, L.C. Nat. Rev. Genet. 2006, 7, 606-619 8. Otsu, M.; Hiles, I.; Gout, I.; Fry, M.J.; Ruiz-Larrea, F.
Product Information Sheet - CS0620
1. Adams, J., Proteasome inhibition in cancer: development of PS-341., Semin. Oncol. 28, 613- 619 (2001). 2. Berenson, J.R., et al., The role of nuclear factor-κΒ in the biology and treatment
Product Information Sheet - CS0660
1. Adams, J., Proteasome inhibition in cancer: development of PS-341., Semin. Oncol. 28, 613- 619 (2001). 2. Berenson, J.R., et al., The role of nuclear factor-κΒ in the biology and treatment
Benzonase®Nuclease
5050 E-mail: merck-aquachim@bgnet.bg Czech Republic Merck spol. s r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: chemie@merck.cz Web: www.merck.cz Hungary Merck Kft. Tel: +36 1 463
Manganese Superoxide Dismutase (MnSOD) Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA. Requirements, features, and performance of high content
Product Information Sheet
Nucleic Acids Res., 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979) Troubleshooting
Bulletin - NA0200S
Nucleic Acids Res., 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979) Troubleshooting
Bulletin - NA0800
Nucleic Acids Res. 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979). 3. Ausubel
Neurotoxicity and Neurite Outgrowth Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA.Requirements, features, and performance of high content
Product Information Sheet - NA0500
Acids Res., 7, 1513-1522 (1979). 8 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979).
p38 MAP Kinase Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA. Requirements, features, and performance of high content
Bulletin - NA0600
Nucleic Acids Res., 7, 1513-1522 (1979). 2. Vogelstein, B., and Gillespie, D., Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA, 76, 615-619 (1979).
Brochure: Chromolith® Monolithic Silica HPLC Columns for small and large molecule separation
Gradient: Time Valve A B C 0 1 100 0 0 2 1 100 0 0 2 2 0 80 20 4 2 0 80 20 9 2 0 50 50 9.5 2 0 50 50 9.6 2 0 80 20 15 2 0 80 20 0
Phospho-Histone H3(Ser 10) & Ki-67 Assay
in growth media until ~70-80% confluent. 2. Detach cells from culture flasks/plates via method appropriate for cell type of interest. Adjust cell density to 5-7 x 104 cells/mL in growth media
BRAND Katalog EN
max. Ø mm Height mm Cat. No. 5 23 34 619 50 10 23 52 619 55 30 37 53 619 60 60 37 92 619 65 90 57 62 619 70
Manganese Superoxide Dismutase (MnSOD) and Histone H2A.X Phosphorylation Assay
A, Taylor DL. Systems cell biology based on high-content screening. Methods Enzymol. 2006;414:601-619. PMID: 17110213 3. Gough AH, Johnston PA.Requirements, features, and performance of high content
Drug Discovery Products & Services - Volume 1, 2014
(See page 11) Log10 (M) Compound ATM vs Inhibitors -11 -10 -9 -8 -7 -6 -5 -4 -3 0 10 20 30 40 50 60 70 80 90 100 110 120 KU-55933 PI-103 PIK-90 % A ct iv ity
Principles of Steam-In-Place
48 76 136 187 305 522 727 1241 2 20 20 38 60 108 148 241 413 575 983 30 30 57 90 162 222 362 619 863 1474 3 20 26 50 79 141 194 316
Imprint Ultra Chromatin Immunoprecipitation Kit User Guide
Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC
Research article: Analytical performance of a commercial multiplex Luminex-based cytokine panel in the rat
619 285 46 Endogenous – 2 88 103 117 Endogenous – 4 141 104 74 IL-12p70a Recombinant 625 2 545 246 45
Novabiochem®Innovations 01/17
3rd International Symposium”, R. Epton (Ed.), Mayflower Worldwide Ltd., Birmingham, 1994, pp. 619. © 2018 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved. Merck and the
Evaluation of Intracellular Signaling - Downstream Chimeric Antigen Receptors
xenograft models of adoptive immunotherapy. Cytotherapy. 2014; 16(5):619–30. Epub 2014/01/21. doi: 10.1016/j.jcyt.2013.10.013S1465-3249(13)00759-7 [pii]. PMID: 24439255; PubMed Central PMCID: PMC3988256. 48
Tools and Tips for Analyzing Apoptosis
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Tools and Tips for Analyzing Apoptosis: A Kit Selection Guide
4864 191 E-mail: kemija@merck.t-com.hr Czech Republic Merck Spol s.r.o. Tel: +420 323 619 323 Fax: +420 323 619 303 E-mail: infochemie@merck.cz www.merck.cz Denmark VWR International ApS Tel: +45
Building blocks for peptide synthesis
Interna tional Symposium”, R. Epton (Ed.), Mayflower Worldwide Ltd., Birmingham, 1994, pp 619. 109. J.P. Tam, et al. (1983) J. Am. Chem. Soc., 105, 6443. 110. A. Dryland &
3D BIOPRINTING: Printing a Brighter Future
collagenase) 35 30 25 20 15 10 5 0 120 100 80 60 40 20 0 100 80 60 40
3D BIOPRINTING: Printing a Brighter Future
collagenase) 35 30 25 20 15 10 5 0 120 100 80 60 40 20 0 100 80 60 40
MultiScreen® and Millicell® Filter Plates for Assay Development
CV = (SD/mean)*100. 1 2 3 4 A 599 601 649 605 B 509 649 631 598 C 584 607 609 618 D 619 550 605 625 C. Spot number by well location
XP725 Antibody List Lot 129K4831
n/d n/d 621 AP2 alpha A9981 7020 TFAP2A M NP_001027451.1 ,NP_001035890.1 ,NP_003211.1 y n/d n/d 619 AP2 beta A9856 7021 TFAP2B M NP_003212.2 y n/d n/d 663 AP2 gamma A3108 7022 TFAP2C M NP_003213.1 y
2/3