695-56-7 | Sigma-Aldrich

Data Sheet - SRP5167

BCR (1-695) (SRP5167) - Datasheet BCR (1-695), GST-tagged, human recombinant, expressed in Sf9 insect cells Catalog Number SRP5167 Storage Temperature –70 °C Synonyms: ALL, CML, PHL, BCR1

Data Sheet - C6455 - Lot 055K8804

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 103K8800

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)- 2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 046K8803

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)-2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 16H5955

Storage Temperature: 2 - 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)- 2-(4-nitrophenyl)ethyl]-, [

Data Sheet - C6455 - Lot 102K8802

Storage Temperature: 2 – 8° Formula: C11H12Cl2N2O5 Formula Weight: 323.13 CAS No: 56-75-7 Synonyms: Acetamide, 2,2-dichloro-N-[2-hydroxy- 1-(hydroxymethyl)- 2-(4-nitrophenyl)ethyl)]-

Data Sheet - C6455 - Lot 067K5014

Reference Standard Catalog Number C6455 Lot Number 067K5014 Storage Temperature 2–8 °C CAS RN 56-75-7 Synonyms: D-threo-(-)-2,2-Dichloro-N-[β-hydroxy- α-(hydroxymethyl)-p-nitropenethyl]Acetamide; Acetamide

Data Sheet - C6455 - Lot 086K8803

Reference Standard Product Number C6455 Lot Number 086K8803 Storage Temperature 2–8 °C CAS RN 56-75-7 Synonyms: D-threo-(–)-2,2-Dichloro-N-[β-hydroxy- α-(hydroxymethyl)-p-nitrophenethyl]acetamide; Acetamide

Data Sheet - A8717

synthetic peptide KMQQNGYENPTYKFFEQMQN corresponding to the C-terminal of human APP695 (amino acids 676-695) conjugated to KLH. This sequence is identical in rat and mouse APP695 and the isoforms APP751 and

Data Sheet - SAB4200816

et al., Eur. J. Immunol., 22, 2513-7 (1992). 11. Clipstone, N., and Crabtree, G., Nature, 357, 695-7 (1992). 12. Yamasaki, Y. et al., Neuroscience, 49, 545-56 (1992). 13. Tůmová, L. et al.

Quality Control Range Sheet- A6041-103 and A6041-203

Control 1 69 - 143 pg/mL Control 2 636 - 1320 pg/mL Control 2 335 - 695 pg/mL IL-17A Control 1 26 - 55

Product Information Sheet - O8801

Tomalia, J.D. DeVrieze, and R.J. Dolinski, Am. Chem. Soc., Div. Org. Coat. Plast. Chem., Pap., 34, 695 (1974); Chem Abstr., 84, 60292r (1976). 34 F. Seela and W. Wesemann, Z. Naturforsch., Teil. C

XP725 Antibody Number-Lot Number 071M4826

c-d e-f g-h a-b c-d e-f g-h 1.1 1 2 3 4 25 26 27 28 49 50 51 52 73 74 75 76 1.2 5 6 7 8 29 30 31 32 53 54 55 56 77 78 79

Glycobiology Brochure

00 81 Tel: (+41) 81 755 2511 Fax: (+41) 81 756 5449 Taiwan SAFC Hitech Tel: (+886) 7 695 5066 Fax: (+886) 7 695 5088 Thailand Tel: (+66) 2 126 8141 Fax: (+66) 2 126 8080 United Kingdom Free Tel

Product Information Sheet - INHIB1

3977-3983 (1982). 54. Alexander, N.M., Anal. Chem., 30(7), 1292-1294 (1958). 55. Knight, C.G., Biochem. J., 189(3), 447-453 (1980). 56. Zollner, H., Handbook of Enzyme Inhibitors (2 nd

Product Information Sheet - BE0100

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

BE0100-Amyloid 1-40 ELISA Human AHPHC

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

Product Information Sheet - BE0200

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

BE0200-Amyloid 1-42 ELISA Human AHPHC

late-onset Alzheimer disease and stability during the course of disease. Arch. Neurol., 56, 673-680 (1999). 7. Kuo, Y. M., et al., Amyloid β peptides interact with plasma proteins and erythrocytes:

Antibody Sourcebookﾙ Sixth Edition

Anti-Amyloid Precursor Protein Mouse mAb (�E9) IB, PS human 1715�7 100 µg €�29 Anti-Amyloid Precursor Protein, C-Terminal (681-695) Goat pAb ELISA, IB human 171599 100 µl €271 Anti-Amyloid Precursor Protein

XP725 Antibody List Lot 129K4831

BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/

XP725 Antibody List Lot 129K4830

BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/

XP725 Antibody List Lot 089K4791

BNIP3 B7931 664 BNIP3 M NP_004043.2 y n/d n/d 79 BTK, C-Terminal B0811 695 BTK P NP_000052.1 y n/d n/d 80 BTK, N-Terminal B0686 695 BTK P NP_000052.1 y n/d n/d 81 BUB1 B0561 699 BUB1 M NP_004327.1 y n/

Calbiochem Biologics 29.2

Aβ peptides. Reacts with a variety of species. Ref.: 1. Barelli, H., et al. 1997. Mol. Med. 3, 695 * EIA: enzyme immunoassay; ELISA: enzyme-linked immunosorbent assay; IB: immunoblotting; IF: immunofluorescence

Bioscience Equipment Catalogue 06 02 15

/50 nm) Green-V (525/30 nm) Yellow-V (583/26 nm) Red-V (695/50 nm) Green-B (525/30 nm) Yellow-B (583/26 nm) Red-B (695/50 nm) NIR-B (785/70 nm) Red-R (661/15 nm) NIR-R (785/70

BRAND Katalog EN

36 SILBERBRAND, AR-Glas® 50* 610 139 38 SILBERBRAND, amber glass 25* 425 139 56 SILBERBRAND, amber glass 50 695 139 58 * reduced distance between subdivision marks III

Imprint Ultra Chromatin Immunoprecipitation Kit User Guide

Primer Sequence Genomic position (hg18) Amplicon size (bp) Actin FP 5' AGTGTGGTCCTGCGACTTCTAAG 3' -695 to -619 chr7:5537367-5537443 77Actin RP 5' CCTGGGCTTGAGAGGTAGAGTGT 3' ZNF333-3’ FP 5’ TGCAGCCAGTGTGGGAAAGC

Antibody SourceBook, Sixth Edition, DIST version

Mouse mAb (56-2A�) FS, IB, PS guinea pig, human, rabbit, rat; not bovine, not hamster, not mouse IM37T 20 µg €113 Anti-MMP-9 (Ab-5) Sheep pAb IB human PC309 200 µg €319 Anti-MMP-9 (Ab-7) Mouse mAb

XP725 Antibody List

SMARCA4,Smarca4 NP_003063.2,NP_035547.2 P y n/d n/d 79 BTK, C-Terminal B0811 695 BTK NP_000052.1 P y n/d n/d 80 BTK, N-Terminal B0686 695 BTK NP_000052.1 P y n/d n/d 81 BUB1 B0561 699 BUB1 NP_004327.1 M y n/d

XP725 Antibody List 013M4793

SMARCA4,Smarca4 NP_003063.2,NP_035547.2 P y n/d n/d 79 BTK, C-Terminal B0811 695 BTK NP_000052.1 P y n/d n/d 80 BTK, N-Terminal B0686 695 BTK NP_000052.1 P y n/d n/d 81 BUB1 B0561 699 BUB1 NP_004327.1 M y n/d