CN
364-31-8
应用筛选条件
关键词:'364-31-8'
显示 1-30 共 44 条结果 关于 "364-31-8" 范围 技术文档
Product Information Sheet - D9542
complex, Ex = 364 nm, Em = 454 nm
(100 mM NaCl, 10 mM EDTA, 10 mM
Tris, pH 7)2
4’,6-Diamidino-2-phenylindole dihydrochloride
D 9542, D8417 (cell culture tested)
Storage temperature 2-8 °C
CAS RN: 28718
Product Information Sheet - D8417
complex, Ex = 364 nm, Em = 454 nm
(100 mM NaCl, 10 mM EDTA, 10 mM
Tris, pH 7)2
4’,6-Diamidino-2-phenylindole dihydrochloride
D 9542, D8417 (cell culture tested)
Storage temperature 2-8 °C
CAS RN: 28718
Product Information Sheet - D9564
complex, Ex = 364 nm, Em = 454 nm
(100 mM NaCl, 10 mM EDTA, 10 mM
Tris, pH 7)2
4’,6-Diamidino-2-phenylindole dihydrochloride
D 9542, D8417 (cell culture tested)
Storage temperature 2-8 °C
CAS RN: 28718
PHYTOMLS - Technical Bulletin
and storage of the data
generated when using the PHYTOMLS.
Components
PHYTOMLS contains 364 unique primary and
secondary plant metabolites, covering Key
metabolic pathways, including the following
Product Information Sheet - 99314
Pflügers Arch. 402, 364 (1984).
12 Resistive artifacts in liquid-ion exchanger microelectrode estimates of Na+ activity in epithelial cells. S. A. Lewis, N. K.
Wills, Biophys. J. 31, 127 (1980).
13 Relations
Product Information Sheet - T0523
et al., J. Clin. Invest., 29(8), 1041-1052
(1950).
9. Jandl, J.H., and Katz, J.H., J. Clin. Invest., 42(3),
314-326 (1963).
10. Finch, C., et al., Blood, 59(2), 364-369 (1982).
11. Inman, R.S
XP725 Antibody Number-Lot Number 071M4826
-h a-b c-d e-f g-h a-b c-d e-f g-h
1.1 1 2 3 4 25 26 27 28 49 50 51 52 73 74 75 76
1.2 5 6 7 8 29 30 31 32 53 54 55 56 77
Product Information Sheet - T4132
1963).
10. Finch, C. et al., Effect of transfused reticulocytes on
iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R.S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T1283
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T0178
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T6011
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T6013
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T1408
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T3309
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
holo-Transferrin human (T0665) - Product Information Sheet
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R.S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Data Sheet - T0665
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R.S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T8158
.
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T2252
1963).
10. Finch, C. et al., Effect of transfused reticulocytes on
iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R.S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T2036
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T5391
1963).
10. Finch, C. et al., Effect of transfused reticulocytes on
iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R.S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Product Information Sheet - T4382
1963).
10. Finch, C. et al., Effect of transfused reticulocytes on
iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R.S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
User Guide-MBD6000
of amplicons in the size range of 250-400 bp (the theoretical fragment sizes are: 287, 324,
342, 364 and 370 bp) See graph below.
Example of the purified library of the 5R-PLEX positive control on a
Product Information Sheet - T1147
).
10. Finch, C., et al., Effect of transfused reticulocytes
on iron exchange. Blood, 59(2), 364-369 (1982).
11. Inman, R. S., and Wessling-Resnick, M.,
Characterization of transferrin-independent
Examination of Non-Specifically Bound Proteins and Peptides Following Depletion of Twenty High Abundance Proteins from Human Plasma
61 1 240 6 342 9 209 6 352 8
IPI00021891 Fibrinogen gamma chain precursor 51 1 68 3 70 1 125 4 175 6 72 3 119 4
IPI00641737 Haptoglobin precursor 321 9 188 6 472 10
Technical Bulletin - FLAGIPT1
of BAP activity.
References
1. Kaboord, B., and Perr, M., Methods Mol. Biol.,
424, 349-364 (2008).
2. Ausubel, F.M. et al. (eds.), Current Protocols in
Molecular Biology. John Wiley & Sons
Application Note - Detection of Tumor-Associated Antigen Gene Expression in Peripheral Blood by RT-PCR
sense, 5'-AGATGCCAAGAGAA-
GATCTC; MART/Melan-A anti-sense, 5'-
GCTCTTAAGGTGAATAAGGTGG, ampli-
fying a 364-bp gene fragment; Tyrosinase
sense, 5'-TTGGCAGATTGTCTGTAGCC;
Tyrosinase anti-sense, 5'-AGGCATTGTGC-
Article: Detection and localization of surgically resectable cancers with a multi-analyte blood test
stm.sciencemag.org/content/scitransmed/7/313/313ra182.full
http://stm.sciencemag.org/content/scitransmed/8/364/364ra155.full
REFERENCES
http://science.sciencemag.org/content/early/2018/02/15/science.aar3247
Halal Certificate
Muhammad Munir Chaudry, Ph.D.
President
This certificate is valid until July 31, 2024 and subject to renewal at that time.
Page 8 of 99
Product Name Product Code Halal-ID Product Certificate #
Halal Certificate
Muhammad Munir Chaudry, Ph.D.
President
This certificate is valid until July 31, 2023 and subject to renewal at that time.
Page 8 of 99
Product Name Product Code Halal-ID Product Certificate #
Affinity Chromatography Media
Interactions between Mouse Immunoglobulins and
Staphylococcal Protein A. Scad J Immunol. 9 (1979) 359-364.
Fahrner, R. Whitney, D.H., Vanderlaan, M., Blank, G.S., (1999) Performance Comparison of Protein
1/2